What is sickle cell disease?
Sickle cell disease is an inherited blood disease. It is caused by a mutated gene found on chromosome 11, the gene for making hemoglobin, the primary component of red blood cells. This then causes the red blood cells to be in the shape of a sickle, rather than a circular shape. Sickled red bloods allow less oxygen to be carried through your red blood cells and for them to stick together rather than flow freely.
Sickle cell disease is an inherited blood disease. It is caused by a mutated gene found on chromosome 11, the gene for making hemoglobin, the primary component of red blood cells. This then causes the red blood cells to be in the shape of a sickle, rather than a circular shape. Sickled red bloods allow less oxygen to be carried through your red blood cells and for them to stick together rather than flow freely.
3.1.1 Blood Detectives
In this activity, we analyzed both normal and sickled cells under a microscope, constructed both normal and sickle cells to test blood flow, and tested hematocrit levels by the centrifuging of "blood".
.
In this activity, we analyzed both normal and sickled cells under a microscope, constructed both normal and sickle cells to test blood flow, and tested hematocrit levels by the centrifuging of "blood".
.
3.1.2 Sickle Cell Diaries
In this activity, we studied the lives of patients living with Sickle Cell Disease. We (my classmates and I) all researched the stages of SCD in different people of different ages and then wrote a diary entry. We then put all this information together into a table.
In this activity, we studied the lives of patients living with Sickle Cell Disease. We (my classmates and I) all researched the stages of SCD in different people of different ages and then wrote a diary entry. We then put all this information together into a table.
Your browser does not support viewing this document. Click here to download the document.
Your browser does not support viewing this document. Click here to download the document.
3.2.1 Transcription/ Translation
Transcription is the process of DNA copying to RNA through RNA polymerace.
Translation is the decoding of RNA to amino acids.
Transcription is the process of DNA copying to RNA through RNA polymerace.
Translation is the decoding of RNA to amino acids.
Your browser does not support viewing this document. Click here to download the document.
3.2.2 DNA to RNA to Amino Acids
DNA is transferred into by changing the following: A to U, T to A, C to G, G to C. RNA is then taken in sets of three and by following the table below to find the chains corresponding amino acid. Examples can be found below.
DNA: ATCGTATCCGGATTACGCGATTGGCCCGAT
RNA: UAG-CAU-AGG-CCU-AAU-GCG-CUA-ACC-GGG-CUA
AA: STOP-His-Arg-Pro-Asn-Ala-His-Thr-Gly-Leu
DNA: TACGCTAACGTACGCTATGGCCTTAATCGC
RNA: AUG-CGA-UUG-CAU-GCG-AUA-CCG-GAA-UUA-GCG
AA: Met-Arg-Leu-His-Ala-Met-Pro-Glu-Leu-Ala
DNA: CATAGCGCCTATCGCATGCCAGTAGCCTAG
RNA: GUA-UCG-CGG-AUA-GCG-UAC-GGU-CAU-CGG-AUC
AA: Val-Ser-Arg-Met-Ala-Tyr-Gly-His-Arg-lle
DNA: ATG-CCG-TGC-TAA-TCG-CCT-AGT-CAG-TCA-TGC
RNA: UAC-GGC-ACG-AUU-AGC-GGA-UCA-GUC-AGU-ACG
AA: Tyr- Gly- Thr- lle- Ser- Gly- Ser- Val- Ser- Thr
DNA: TGC-ACT-GAT-CTG-ACT-CAG-CTA-CGT-ACG-TCC
RNA: ACG-UGA-CUA-GAC-UGA-GUC-GAU-GCA-UGC-AGG
AA: Thr- STOP- Leu- Asp- STOP- Val- Asp- Ala- Cys- Arg
DNA is transferred into by changing the following: A to U, T to A, C to G, G to C. RNA is then taken in sets of three and by following the table below to find the chains corresponding amino acid. Examples can be found below.
DNA: ATCGTATCCGGATTACGCGATTGGCCCGAT
RNA: UAG-CAU-AGG-CCU-AAU-GCG-CUA-ACC-GGG-CUA
AA: STOP-His-Arg-Pro-Asn-Ala-His-Thr-Gly-Leu
DNA: TACGCTAACGTACGCTATGGCCTTAATCGC
RNA: AUG-CGA-UUG-CAU-GCG-AUA-CCG-GAA-UUA-GCG
AA: Met-Arg-Leu-His-Ala-Met-Pro-Glu-Leu-Ala
DNA: CATAGCGCCTATCGCATGCCAGTAGCCTAG
RNA: GUA-UCG-CGG-AUA-GCG-UAC-GGU-CAU-CGG-AUC
AA: Val-Ser-Arg-Met-Ala-Tyr-Gly-His-Arg-lle
DNA: ATG-CCG-TGC-TAA-TCG-CCT-AGT-CAG-TCA-TGC
RNA: UAC-GGC-ACG-AUU-AGC-GGA-UCA-GUC-AGU-ACG
AA: Tyr- Gly- Thr- lle- Ser- Gly- Ser- Val- Ser- Thr
DNA: TGC-ACT-GAT-CTG-ACT-CAG-CTA-CGT-ACG-TCC
RNA: ACG-UGA-CUA-GAC-UGA-GUC-GAU-GCA-UGC-AGG
AA: Thr- STOP- Leu- Asp- STOP- Val- Asp- Ala- Cys- Arg
3.2.3 Hydrophillic/Hydrophobic
In this activity, we did an online module to test hydrophillic (water loving) and hydrophobic cells in different substances.
In this activity, we did an online module to test hydrophillic (water loving) and hydrophobic cells in different substances.
3.3.1 Meiosis
In this activity, we first examined meiosis and mitosis in various organisms. We then took chromosomes from both a mom and dad sex cell and made two "babies". The data table shows the gender and if any of the babies have either SCD, Best Diesease, or Hemophilia.
In this activity, we first examined meiosis and mitosis in various organisms. We then took chromosomes from both a mom and dad sex cell and made two "babies". The data table shows the gender and if any of the babies have either SCD, Best Diesease, or Hemophilia.
3.4.1 Pedigrees
In this activity, we were given a gel electrophoresis and a pedigree of Anna Garcia's family to complete to analyze the family history of sickle cell disease.
In this activity, we were given a gel electrophoresis and a pedigree of Anna Garcia's family to complete to analyze the family history of sickle cell disease.
3.4.2 Punnett Squares
A Punnett square is used to determine the probability of an offspring having a trait.
Ex:
Let t be the dominant gene for tall.
Let T be the recessive gene for short.
Lexi Lue and Peter Pepper want to know the probability of there children being tall, like Lexi Lu. For Lexi Lu, she is tall because both her father (tt) and her mother (tt) are tall. For Peter Pepper, he is short. His mother is short (TT) and his father is tall (Tt). Use their family history to make a punnett square for their children. (Remember to be short, the genotype must be TT.)
Answer: t t
T Tt Tt 100% tall BECAUSE you must be TT to have a short phenotype.
T Tt Tt
A Punnett square is used to determine the probability of an offspring having a trait.
Ex:
Let t be the dominant gene for tall.
Let T be the recessive gene for short.
Lexi Lue and Peter Pepper want to know the probability of there children being tall, like Lexi Lu. For Lexi Lu, she is tall because both her father (tt) and her mother (tt) are tall. For Peter Pepper, he is short. His mother is short (TT) and his father is tall (Tt). Use their family history to make a punnett square for their children. (Remember to be short, the genotype must be TT.)
Answer: t t
T Tt Tt 100% tall BECAUSE you must be TT to have a short phenotype.
T Tt Tt